View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12742_high_25 (Length: 240)
Name: NF12742_high_25
Description: NF12742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12742_high_25 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 29662521 - 29662299
Alignment:
| Q |
18 |
taaacacacaaagagcaatattgattttgattgtaggaaaactaatgtcaccacagtcaatattttactgggaaatcatggagttacgaatgcaggaatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29662521 |
taaacacacaaagagcaatattgattttgattgtaggaaaactaatgtcaccacagtcaatattttactgggaaatcatggagttacgaatgcaggaatt |
29662422 |
T |
 |
| Q |
118 |
acccgatgcgcatttcaatttttnnnnnnncatattgagcattagctattatcgatataggattaattcgcataactataaaatgaattgattacttagg |
217 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29662421 |
acccaatgcgcatttcaatttttaaaaaaacatattgagcattagctattatcgatataggattaattcgcataactataaaatgaattgattacttagg |
29662322 |
T |
 |
| Q |
218 |
atttagatggacaatgtctacat |
240 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
29662321 |
atttagatggacaatgtctacat |
29662299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 160 - 231
Target Start/End: Original strand, 33183432 - 33183501
Alignment:
| Q |
160 |
tagctattatcgatataggattaattcgcataactataaaatgaattgattacttaggatttagatggacaa |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || || ||||||| |||||||||||||||||||||| |
|
|
| T |
33183432 |
tagctattatcgatataggattaattcgcataac--tagaacgaattgactacttaggatttagatggacaa |
33183501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University