View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12742_low_15 (Length: 317)
Name: NF12742_low_15
Description: NF12742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12742_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 11 - 298
Target Start/End: Complemental strand, 46350076 - 46349789
Alignment:
| Q |
11 |
agatgaaagagatgataagaaaaggagggctgagtatattcttagacagtctatggagaatcgacaagaactcactcttttgtaggttctgaggctgaag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46350076 |
agatgaaagagatgataagaaaaggagggctgagtatattcttagacagtctatggagaatcgacaagaactcactcttttgtaggttctgaggctgaag |
46349977 |
T |
 |
| Q |
111 |
ttacgggctttccgatgttctggtgaggattttgtgactgacatgtagaattcatagtagtgactatattttagagctgttaaatttgattccttttttg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46349976 |
ttacgggctttccgatgttctggtgaggattttgtgactgacatgtagaattcatagtagtgactatattttagagctgttaaatttgattccttttttg |
46349877 |
T |
 |
| Q |
211 |
ctggtaaaactctatttggtggcgtacatatttttaaagatagaggtctttggttattgtaatatttgtgaactaacagcttgatagc |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46349876 |
ctggtaaaactctatttggtggcgtacatatttttaaagatagaggtctttggttattgtaatatttgtgaactaacagcttgatagc |
46349789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University