View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12742_low_26 (Length: 242)
Name: NF12742_low_26
Description: NF12742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12742_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 36416114 - 36415892
Alignment:
| Q |
1 |
ctggtattagagacatgaaacctacattggttcttaatagaatcacttattggcaaaggttgttggatagagctattggtacgagaccgactggagcggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36416114 |
ctggtattagagacatgaaacctacattggttcttaatagaatcacttattggcaaaggttgttggatagagctattggtacgagaccgactggagcggc |
36416015 |
T |
|
| Q |
101 |
taagaataatcgtttggttcagatttctctttatgctgttgtgcaagaaagttttgatctttacaaagatatctctgatgggcttggggttgttttggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36416014 |
taagaataatcgtttggttcagatttctctttatgctgttgtgcaagaaagttttgatctttacaaagatatctctgatgggcttggggttgttttggat |
36415915 |
T |
|
| Q |
201 |
aatttcttcaatttaccactttc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
36415914 |
aatttcttcaatttaccactttc |
36415892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University