View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12742_low_31 (Length: 206)
Name: NF12742_low_31
Description: NF12742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12742_low_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 14 - 186
Target Start/End: Original strand, 30654609 - 30654781
Alignment:
| Q |
14 |
ttcactgtggggtttgcaactgccatttgttgtgctcgtcgttattgtttttgcgacctatgtttgatttcctaacgtttctctgccgctctttctaagg |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30654609 |
ttcactgtggggtttgcaactgccatttgttgtgctcgtcgttattgtttttgcgacctatgtttgatttcttaacgtttctctgccgctctttctaagg |
30654708 |
T |
|
| Q |
114 |
ttgtcgttgctttgtggtttgccggttcgtgggttccagtccaagttcagatctgcgtgtttagatgctcgct |
186 |
Q |
| |
|
|| | |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30654709 |
ttaccattgctttgtggtttgctggttcgtgggttccagtccaagttcagatctgcgtgtttagatgctcgct |
30654781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 19 - 77
Target Start/End: Original strand, 38927753 - 38927811
Alignment:
| Q |
19 |
tgtggggtttgcaactgccatttgttgtgctcgtcgttattgtttttgcgacctatgtt |
77 |
Q |
| |
|
||||||||||||||| || ||| ||||||||||||||| ||||||| ||||||| |||| |
|
|
| T |
38927753 |
tgtggggtttgcaaccgctattggttgtgctcgtcgttgttgttttggcgacctctgtt |
38927811 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University