View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12742_low_32 (Length: 201)
Name: NF12742_low_32
Description: NF12742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12742_low_32 |
 |  |
|
| [»] scaffold0339 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0339 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 23 - 186
Target Start/End: Original strand, 16077 - 16240
Alignment:
| Q |
23 |
agggaaaggcaaggatgctgattgggtgcaaaaagctaatatagctttgaataaggtatatctcgtttcattgtgtatgtttggaatcacagtgacaccg |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16077 |
agggaaaggcaaggatgctgattgggtgcaaaaagctaatatagctttgaataaggtatatctcgtttcattgtgtatgtttggaatcacagtgacacca |
16176 |
T |
 |
| Q |
123 |
cggttctatgaaactcgtgtcaattcaaacatgcacttaaatgcattcactgtgaacccctttg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16177 |
cggttctatgaaactcgtgtcaattcaaacatgcacttaaatgcattcactgtgaacccctttg |
16240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339; HSP #2
Raw Score: 60; E-Value: 8e-26
Query Start/End: Original strand, 127 - 186
Target Start/End: Complemental strand, 2925 - 2866
Alignment:
| Q |
127 |
tctatgaaactcgtgtcaattcaaacatgcacttaaatgcattcactgtgaacccctttg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2925 |
tctatgaaactcgtgtcaattcaaacatgcacttaaatgcattcactgtgaacccctttg |
2866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 60; Significance: 8e-26; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 8e-26
Query Start/End: Original strand, 127 - 186
Target Start/End: Complemental strand, 47273700 - 47273641
Alignment:
| Q |
127 |
tctatgaaactcgtgtcaattcaaacatgcacttaaatgcattcactgtgaacccctttg |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47273700 |
tctatgaaactcgtgtcaattcaaacatgcacttaaatgcattcactgtgaacccctttg |
47273641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 68 - 105
Target Start/End: Complemental strand, 47296422 - 47296385
Alignment:
| Q |
68 |
tttgaataaggtatatctcgtttcattgtgtatgtttg |
105 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47296422 |
tttgaataaggtatatcttgtttcattgtgtatgtttg |
47296385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University