View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12743_high_12 (Length: 325)
Name: NF12743_high_12
Description: NF12743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12743_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 1 - 315
Target Start/End: Original strand, 29134810 - 29135124
Alignment:
| Q |
1 |
atttcttctaaacctaccttttcatacccgcctgagttgtttgcaaatgcaccatacatttgacaagacctaatcccactttttctgaaactattaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29134810 |
atttcttctaaacctaccttttcataccagcctgagttgtttgcaaatgcaccatacatttgacaaggcctaatcccactttttctgaaactattaattt |
29134909 |
T |
|
| Q |
101 |
gagatatcttcttcactgatttttctgtgtcctagtaacaacaaacaatacttctcttccaacaatatgtgattatgctcgtcgctgaaaagggtcacat |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29134910 |
gagatatcttcttctctgatttttctgtgtcctagtaacaacaaacaatacttctcttccaacaatatgtgattatgctcgtcgctgaaaagggtcacat |
29135009 |
T |
|
| Q |
201 |
accacctccctgatcttaagtcgatgtgaacacgaaatttagccaaacaaccacacctagtttcacgcctttgttcccgctttcaactatcattggtcaa |
300 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29135010 |
accaactccctgatcttaagtcgatgcgaacacgaaatttagccagacaaccacacctactttcacgcctttgttcccgctttcaactatcattggtcaa |
29135109 |
T |
|
| Q |
301 |
accatgtcttctctg |
315 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
29135110 |
accatgtcttctctg |
29135124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University