View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12743_high_7 (Length: 386)
Name: NF12743_high_7
Description: NF12743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12743_high_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 2e-99; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 4931334 - 4931061
Alignment:
| Q |
1 |
ttagcgtatgattcgtattacggtgagtatgtcagagtgatagcgatctaccttgacttttcaaaaactaaactttgtagtttctgtaaaatcacggtag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| ||||||||||||| ||||||||||||| | |
|
|
| T |
4931334 |
ttagcgtatgattcgtattacggtgagtatgtcagagtgacagcgatctacagtgacttttcaaaaactacactttgtagtttccgtaaaatcacggtgg |
4931235 |
T |
 |
| Q |
101 |
gtca---------------ccgtgattctaacatactcgcagggataccaaatatacactaagaatttacacacatgtgagatgtggcgcatcccttcac |
185 |
Q |
| |
|
||| |||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4931234 |
atcatcccttcacaaatcaccgtgattctaacatacttgcaggaataccaaatatacactaagaatttacacacatgtgagatgtggcacatcccttcac |
4931135 |
T |
 |
| Q |
186 |
aaattagtttatgttttatgatatctttgttataaatataaggttttaatgcatttttggtcccctaattcaac |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4931134 |
aaattagtttatgttttatgatatctttgttataaatataaggttttaatgcatttttggtcccctaattcaac |
4931061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 320 - 386
Target Start/End: Complemental strand, 4930977 - 4930911
Alignment:
| Q |
320 |
ttttagagtcatttttaccgatgtgggaactcttaataggctttttatgtcatggatatccagtgta |
386 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4930977 |
ttttggagtcatttttaccgatgtgggaactcttaataggctttttatgtcatggatatccggtgta |
4930911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 279 - 324
Target Start/End: Complemental strand, 4931046 - 4931001
Alignment:
| Q |
279 |
tatccccattttaaaaccattttttattcctctaacttcactttta |
324 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4931046 |
tatccccattttaaaacaattttttattcctctaacttcactttta |
4931001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 45 - 114
Target Start/End: Complemental strand, 5173854 - 5173785
Alignment:
| Q |
45 |
gatctaccttgacttttcaaaaactaaactttgtagtttctgtaaaatcacggtaggtcaccgtgattct |
114 |
Q |
| |
|
|||||||| ||| |||| |||| ||| | ||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
5173854 |
gatctaccgtgatttttaaaaatctacattttgtagcttctgtaaaatcacggtagatcaccgtgattct |
5173785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 144
Target Start/End: Complemental strand, 17890785 - 17890713
Alignment:
| Q |
72 |
actttgtagtttctgtaaaatcacggtaggtcaccgtgattctaacatactcgcagggataccaaatatacac |
144 |
Q |
| |
|
||||| |||||| ||||||||||| || | ||||||||||||| |||||| | | | ||||||||| |||||| |
|
|
| T |
17890785 |
actttatagtttatgtaaaatcacagtggatcaccgtgattctgacatacccacggtgataccaaacatacac |
17890713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 58 - 90
Target Start/End: Complemental strand, 9436154 - 9436122
Alignment:
| Q |
58 |
ttttcaaaaactaaactttgtagtttctgtaaa |
90 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
9436154 |
ttttcaaaaactacactttgtagtttctgtaaa |
9436122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University