View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12744_high_4 (Length: 254)
Name: NF12744_high_4
Description: NF12744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12744_high_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 9 - 235
Target Start/End: Original strand, 19514272 - 19514498
Alignment:
| Q |
9 |
agcagagacagaccaagtaagtgcatcagaggaaagatcaagcatatcaatgcaatcagaaacagcattagagagacgtgaatctccaaatccagaacca |
108 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19514272 |
agcagaggcagaccaagtaagtgcatcagaggaaagatcaagcatatcaatgcaatcagaaacagcattagagagacgtgaatctccaaatccagaacca |
19514371 |
T |
 |
| Q |
109 |
ccaaattgagaaagaatggacattacttcttgcaaaatgccaacaacatcttgcactgtcccaacaaattcagatggagcaaccttaagaaactcaaatt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19514372 |
ccaaattgagaaagaatggacattacttcttgcaaaatgccaacaacatcttgcactgtcccaacaaattcagatggagcaaccttaagaaactcaaatt |
19514471 |
T |
 |
| Q |
209 |
cagatgctgctttagtgggagcactag |
235 |
Q |
| |
|
|||||| |||||||||||||||||||| |
|
|
| T |
19514472 |
cagatgttgctttagtgggagcactag |
19514498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University