View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12745_low_5 (Length: 221)
Name: NF12745_low_5
Description: NF12745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12745_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 9 - 211
Target Start/End: Original strand, 3717484 - 3717691
Alignment:
| Q |
9 |
ggagaagcacagaggtgagtgtggtgttctcatttttcactatgagtttgtaccatatgcttctttcgtgggataccagggcattcacagagattttgtg |
108 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3717484 |
ggagaaacaaagaggtgagtgtggtgttctcatttttcactatgagttggtactctatgcttctttcgtgggataccagggcattcactgagattttgtg |
3717583 |
T |
 |
| Q |
109 |
agaatttattccccatggatttcactgatggagtttgtggatagaggacaagaactttgagcaaagtttcatcatatg-----atgtatagctatagttt |
203 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3717584 |
agaatttattccccatggatttcgatgatggagtttgtggatagaggacaagaactttgagcaaagtttcatcatatgatgtaatgtatagctatagttt |
3717683 |
T |
 |
| Q |
204 |
atgatgtc |
211 |
Q |
| |
|
|||||||| |
|
|
| T |
3717684 |
atgatgtc |
3717691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University