View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12748_high_11 (Length: 229)
Name: NF12748_high_11
Description: NF12748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12748_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 5e-77; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 7 - 171
Target Start/End: Complemental strand, 28093089 - 28092920
Alignment:
| Q |
7 |
taaactactgatcaatacatatatt-----tatgattagtatctggtcctgattctcttggagaattgttatgtgttttgcttattccatccgttgggtt |
101 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28093089 |
taaactactgatcaatacatatattatatttatgattagtatctggtcctgattctcttggagaattgttatgtgttttgcttattccatccgttgggtt |
28092990 |
T |
|
| Q |
102 |
tgagtgggtcctgaaacccttaaacttagttttacttttgcactgcagtgtcatcatgtatcagaaaaac |
171 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28092989 |
tgagtgggtcctgaaacctttaaacttagttttacttttgcactgcagtgtcatcatgtatcagaaaaac |
28092920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 163 - 229
Target Start/End: Complemental strand, 28092739 - 28092673
Alignment:
| Q |
163 |
cagaaaaacacaggaaacttccctgataagaaaacacattaactaaatggaattggatggtgcaatt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28092739 |
cagaaaaacacaggaaacttccctgataagaaaacacattaactaaatggaattggatggtgcaatt |
28092673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 126 - 191
Target Start/End: Complemental strand, 28042741 - 28042676
Alignment:
| Q |
126 |
cttagttttacttttgcactgcagtgtcatcatgtatcagaaaaacacaggaaacttccctgataa |
191 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||| || |||||||||| ||||||| |
|
|
| T |
28042741 |
cttagttttacttttgcactgcagtgtcaccatgtatcagaaaagcaaaggaaacttcactgataa |
28042676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University