View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12748_low_11 (Length: 249)
Name: NF12748_low_11
Description: NF12748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12748_low_11 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 9 - 249
Target Start/End: Original strand, 4933352 - 4933592
Alignment:
| Q |
9 |
agaagcaaaggaataacgtagaatctgtgtctatggtatatgttgagaagacaaagtcatattcttcagatgaagatgtttcagacacctcatcaaattc |
108 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4933352 |
agaaccaaaagaataacgtagaatctgtgtctatggtatatgttgagaagacaaagtcatattcttcagatgaagatgtttcagaaacctcatcaaattc |
4933451 |
T |
 |
| Q |
109 |
tggctatggtaattgttgtcacactcaaacctcaaaaccaagtaggtcactgcctgaagttgaggcaagagtgtcagagaaaaacgtgctgattcgtgtc |
208 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4933452 |
tggctatggtaattgttgtcacactcacacctcaaaaccaagtaggtcactgcctgaagttgaggcaagagtgtcagagaaaaacgtgctgattcgtgtc |
4933551 |
T |
 |
| Q |
209 |
cattgtgagaaacataagggtgcattgatgaacataatcca |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4933552 |
cattgtgagaaacataagggtgcattgatgaacataatcca |
4933592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University