View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1274_high_101 (Length: 204)

Name: NF1274_high_101
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1274_high_101
NF1274_high_101
[»] chr8 (1 HSPs)
chr8 (1-117)||(10413988-10414104)


Alignment Details
Target: chr8 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 10414104 - 10413988
Alignment:
1 aaaagaagccatggtgtgttgaatatattgggatggggtatctttatcataatgggagcaatagttgctcgttacttcaaggattgggatccattttggt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10414104 aaaagaagccatggtgtgttgaatatattgggatggggtatctttatcataatgggagcaatagttgctcgttacttcaaggattgggatccattttggt 10414005  T
101 ttaattttcatgcttca 117  Q
    |||||||||||||||||    
10414004 ttaattttcatgcttca 10413988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University