View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1274_high_39 (Length: 379)
Name: NF1274_high_39
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1274_high_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-134; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 67 - 330
Target Start/End: Original strand, 36953202 - 36953468
Alignment:
| Q |
67 |
tttcccacaatcaaattcagtttggtataatta----cttgggaaaaatttatctttaggagtgtattaattggaatattggtggattttatttatggtc |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36953202 |
tttcccacaatcaaattcagtttggtataattaattacttgggaaaaatt-atctttaggagtgtattaattggaatattggtggattttatttatggtc |
36953300 |
T |
 |
| Q |
163 |
atatatatttgcctttttctttcttattcaaatttaaacacttttccaatgatgaaatggggtctcaactctgaagaattgtgtacttggtatggggaat |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36953301 |
atatatatttgcctttttctttcttattcaaatttaaacacttttccaatgatgaaatggggtctcaactctgaagaattgtgtacttggtatggggaat |
36953400 |
T |
 |
| Q |
263 |
tgtgcaattcttcatatttgcaagctttatttgtgtttttgagatgaaaagtgcagttcaaaattaag |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36953401 |
tgtgcaattcttcatatttgcaagctttatttgtgtttttgagatgaaaagtgcagttcaaaattaag |
36953468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University