View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1274_high_40 (Length: 376)
Name: NF1274_high_40
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1274_high_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 270 - 370
Target Start/End: Original strand, 2298357 - 2298457
Alignment:
| Q |
270 |
tttcgggtgacgattgcttaagataatctttttctctctgatttaattacagggataaacttgggtgaaacattttttcatgtgaaaattgcctatgata |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |||| ||||||| |
|
|
| T |
2298357 |
tttcgggtgacgattgcttaagataatctttttctctctgatttaattacagggataagcttgggtgaaatattttttcatgtgaaagttgcttatgata |
2298456 |
T |
 |
| Q |
370 |
c |
370 |
Q |
| |
|
| |
|
|
| T |
2298457 |
c |
2298457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University