View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1274_high_47 (Length: 336)
Name: NF1274_high_47
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1274_high_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 28 - 300
Target Start/End: Complemental strand, 43079266 - 43078994
Alignment:
| Q |
28 |
cagaaggtgcggctcttcaagggtctggatgggtggtaagttttgtggattttgaaatttccagcatgtattctatgtatatcattagagctcgatgatt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43079266 |
cagaaggtgcggctcttcaagggtctggatgggtggtaagttttgtggattttgaaatttccagcatgtattctatgtatatcattagagctcgatgatt |
43079167 |
T |
 |
| Q |
128 |
gtttttatttgaagtgcccttgttttgttttaatcaatttgtactgcattgccagtggcttgctcttgacaaagaattgaagaggcttgtggttgaaacc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43079166 |
gtttttatttgaagtgcccttgttttgttttaatcaatttgtactgcattgccagtggcttgctcttgacaaagaattgaagaggcttgtggttgaaacc |
43079067 |
T |
 |
| Q |
228 |
actgcaaaccaggtaaacttcctctcttccccttccacctctaacaaaccttgtcccttttccaagatgctaa |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43079066 |
actgcaaaccaggtaaacttcctctcttccccttccacctctaacaaaccttgtcccttttccaagatgctaa |
43078994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University