View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1274_high_62 (Length: 277)
Name: NF1274_high_62
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1274_high_62 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 56 - 239
Target Start/End: Complemental strand, 5824739 - 5824556
Alignment:
| Q |
56 |
ggaggagaatttaaagaagttagtttagtttaaatttatagccatatacacaactaccacaacatattcttatctttaggttcttgaccgcattaagctt |
155 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5824739 |
ggaggagaatttcaagaagttagtttagtttaaatttagagccatatacacaactaccacaacatattcttatctttaggttcttgaccgcattaagctt |
5824640 |
T |
|
| Q |
156 |
catacatggtcgtggccgaaggcgtataaacttgaatttttatttgatttgcatacatggtggattaactcatctctttgtctc |
239 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5824639 |
catacatggtcgtggccaaaggcgtataaacttgaatttttatttgatttgcatacatggtggattaactcatctctttgtctc |
5824556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University