View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1274_high_71 (Length: 255)
Name: NF1274_high_71
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1274_high_71 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 44 - 242
Target Start/End: Complemental strand, 39956105 - 39955908
Alignment:
| Q |
44 |
ttctaaagggaaaatgtccctgataattcagagtttgaccgtgaggtaagtaaagtccgtcaaagatagttcggatagattcaaactcccgataggaact |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39956105 |
ttctaaagggaaaatgtccctgataattcagagtttgaccgtgaggtaagtaaagtccgtcaaagatagttcggatagattcaaactcccgataggaact |
39956006 |
T |
 |
| Q |
144 |
gcagagctgtgagatataaaacatgaggtgtttaaagcttggctctttatttttcagtgtatgttacnnnnnnnnagtatattataattgtatattctt |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39956005 |
gcagagctgtgagatataaaacatgaggtgtttaaagtttggctctttatttttcagtgtatgttac-tttttttagtatattataattgtatattctt |
39955908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University