View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1274_high_82 (Length: 249)
Name: NF1274_high_82
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1274_high_82 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 36085100 - 36085334
Alignment:
| Q |
1 |
attatatatttgggaggtagctcaacaccggtaaaa-gataaagcaaatgttccgtagcagactcgaagattagtttcataatggactcaataaacttaa |
99 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||| |||||||||||||| | |||| ||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
36085100 |
attatatatttggaaggtagctcaacactggtaaaaagataaagcaaatgtcctatagcggactcgaagattagtttcatagcggatccaataaacttag |
36085199 |
T |
 |
| Q |
100 |
tggaagaaaactcaaaaagtctatcatagctaaacaaatatttactgcctcctttactcaaaagccaacttaagtatatctggcacctttggaattttaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36085200 |
tggaagaaaactcaaaaagtctatcatagctaaacaaatatttactgcctcctttactcaaaagccaacttaagtatatctggcacctttggaattttaa |
36085299 |
T |
 |
| Q |
200 |
taatttgttgagtagtcttatacgtagtgagtact |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
36085300 |
taatttgttgagtagtcttatacgtagtgagtact |
36085334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University