View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1274_high_87 (Length: 241)

Name: NF1274_high_87
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1274_high_87
NF1274_high_87
[»] chr3 (1 HSPs)
chr3 (1-130)||(42479965-42480094)


Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 42480094 - 42479965
Alignment:
1 acctggtgctcaaatttcacctattgaaattgcttctcagctcccaacaactaaccctgaagcaccggttatgctggaccgtatcttgcgtctattggct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42480094 acctggtgctcaaatttcacctattgaaattgcttctcagctcccaacaactaaccctgaagcaccggttatgctggaccgtatcttgcgtctattggct 42479995  T
101 tgttacaatatcctcacaggttctgctcgt 130  Q
    |||||||||||||||||  |||||| ||||    
42479994 tgttacaatatcctcacttgttctgttcgt 42479965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University