View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1274_high_88 (Length: 237)

Name: NF1274_high_88
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1274_high_88
NF1274_high_88
[»] chr7 (2 HSPs)
chr7 (129-213)||(46230737-46230821)
chr7 (57-105)||(46230837-46230885)


Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 129 - 213
Target Start/End: Complemental strand, 46230821 - 46230737
Alignment:
129 tgctcataacatacggaggaataaattgcatcaccgatttgatgagaacttctcataccggcttgagataagcccttgctactcc 213  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46230821 tgctcataacatacggaggaataaattgcatcaccgatttgatgagaacttctcataccggcttgagataagcccttgctactcc 46230737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 57 - 105
Target Start/End: Complemental strand, 46230885 - 46230837
Alignment:
57 aaagaattcaacatcttatcaatttcatcaataagagaggacaacgttt 105  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||    
46230885 aaagaattcaacatcttatcaatttcatcactaagagaggacaacgttt 46230837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University