View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1274_high_88 (Length: 237)
Name: NF1274_high_88
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1274_high_88 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 129 - 213
Target Start/End: Complemental strand, 46230821 - 46230737
Alignment:
| Q |
129 |
tgctcataacatacggaggaataaattgcatcaccgatttgatgagaacttctcataccggcttgagataagcccttgctactcc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46230821 |
tgctcataacatacggaggaataaattgcatcaccgatttgatgagaacttctcataccggcttgagataagcccttgctactcc |
46230737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 57 - 105
Target Start/End: Complemental strand, 46230885 - 46230837
Alignment:
| Q |
57 |
aaagaattcaacatcttatcaatttcatcaataagagaggacaacgttt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
46230885 |
aaagaattcaacatcttatcaatttcatcactaagagaggacaacgttt |
46230837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University