View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1274_low_111 (Length: 221)
Name: NF1274_low_111
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1274_low_111 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 6314317 - 6314218
Alignment:
| Q |
1 |
atttaacttaccaagacccagaaactccatccacaagcccattgattctatcacctgtgatgcaaccaactctcatgacttcatcagcaacattcatatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6314317 |
atttaacttaccaagacccagaaactccatccacaagcccattgattctatcacctgtgatgcaaccaactctcataacttcatcagcaacattcatatc |
6314218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 26 - 100
Target Start/End: Complemental strand, 6329500 - 6329426
Alignment:
| Q |
26 |
tccatccacaagcccattgattctatcacctgtgatgcaaccaactctcatgacttcatcagcaacattcatatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||| ||||| | ||| ||||||||||||||||| |
|
|
| T |
6329500 |
tccatccacaagcccattgattctatcacctatcatgcaaccaacactcataaattcttcagcaacattcatatc |
6329426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 5 - 100
Target Start/End: Complemental strand, 56537993 - 56537898
Alignment:
| Q |
5 |
aacttaccaagacccagaaactccatccacaagcccattgattctatcacctgtgatgcaaccaactctcatgacttcatcagcaacattcatatc |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| || ||||| |||||||||| |||||| |
|
|
| T |
56537993 |
aacttaccaagacccagaaactccgtccacaagccctttgattctatcacctgtgatgcaaccaactccaataacttcttcagcaacatccatatc |
56537898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University