View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1274_low_118 (Length: 206)
Name: NF1274_low_118
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1274_low_118 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 29 - 185
Target Start/End: Original strand, 46230737 - 46230885
Alignment:
| Q |
29 |
ggagtagcaagggcttatctcaagccggtatgagaagttctcatcaaatcggtgatgcaatttattcctccgtatgttatgagcannnnnnnnnnnnnnn |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46230737 |
ggagtagcaagggcttatctcaagccggtatgagaagttctcatcaaatcggtgatgcaatttattcctccgtatgttatgagca--------ttttttt |
46230828 |
T |
|
| Q |
129 |
nnnnnattaaacgttgtcctctcttattgatgaaattgataagatgttgaattcttt |
185 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
46230829 |
tttttattaaacgttgtcctctcttagtgatgaaattgataagatgttgaattcttt |
46230885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University