View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1274_low_119 (Length: 205)
Name: NF1274_low_119
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1274_low_119 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 3683913 - 3684031
Alignment:
| Q |
1 |
tgttgatcctcattgctcagatactatgtgcttgtcaatcaaacaagatgttttcccattttcaca-ttttttgtttagcaaatatttatggtcgaaata |
99 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3683913 |
tgttgatcctcattgctcagatactctgtgcttgtcaatcaaataagatgttttccctttttcacatttttttgtttagcaaatatttatggtcgaaata |
3684012 |
T |
 |
| Q |
100 |
ttgaatcaagtaatttttt |
118 |
Q |
| |
|
|||||||| |||||||||| |
|
|
| T |
3684013 |
ttgaatcaggtaatttttt |
3684031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University