View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1274_low_122 (Length: 204)
Name: NF1274_low_122
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1274_low_122 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 8e-60; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 10414104 - 10413988
Alignment:
| Q |
1 |
aaaagaagccatggtgtgttgaatatattgggatggggtatctttatcataatgggagcaatagttgctcgttacttcaaggattgggatccattttggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10414104 |
aaaagaagccatggtgtgttgaatatattgggatggggtatctttatcataatgggagcaatagttgctcgttacttcaaggattgggatccattttggt |
10414005 |
T |
 |
| Q |
101 |
ttaattttcatgcttca |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
10414004 |
ttaattttcatgcttca |
10413988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University