View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1274_low_126 (Length: 201)
Name: NF1274_low_126
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1274_low_126 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 7 - 189
Target Start/End: Complemental strand, 8176243 - 8176065
Alignment:
| Q |
7 |
tattcctggtctttacaggattgtccaggtagcatatactatagcacttccatgtcattaatattatgcttgcaaaactacaaaaaagattgtgatatag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8176243 |
tattcctggtctttacaggattgtccaggtagcatatactatagcacttccatgtcattaatattatgcttgcaaaactacaaaaaagattgtgatatag |
8176144 |
T |
 |
| Q |
107 |
taactgatttagtgacaaatcggtttatagaccaaaattgacaaattggtcataatattagcaactagttatttagcgatatt |
189 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8176143 |
taactgatttagtg----atcggtttatagaccaaaattgacaaatcggtcataatattagcaactagttatttagcgatatt |
8176065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University