View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1274_low_126 (Length: 201)

Name: NF1274_low_126
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1274_low_126
NF1274_low_126
[»] chr1 (1 HSPs)
chr1 (7-189)||(8176065-8176243)


Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 7 - 189
Target Start/End: Complemental strand, 8176243 - 8176065
Alignment:
7 tattcctggtctttacaggattgtccaggtagcatatactatagcacttccatgtcattaatattatgcttgcaaaactacaaaaaagattgtgatatag 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8176243 tattcctggtctttacaggattgtccaggtagcatatactatagcacttccatgtcattaatattatgcttgcaaaactacaaaaaagattgtgatatag 8176144  T
107 taactgatttagtgacaaatcggtttatagaccaaaattgacaaattggtcataatattagcaactagttatttagcgatatt 189  Q
    ||||||||||||||    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
8176143 taactgatttagtg----atcggtttatagaccaaaattgacaaatcggtcataatattagcaactagttatttagcgatatt 8176065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University