View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1274_low_41 (Length: 386)
Name: NF1274_low_41
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1274_low_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 98 - 314
Target Start/End: Complemental strand, 44694802 - 44694586
Alignment:
| Q |
98 |
ttaggaacaagcattctgtccctgggagccaatgttgccttgcacataccaacaagatcaataaccaagttgactgctggcttcggcttaaacactgcct |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44694802 |
ttaggaacaagcattctgtccctgggagccaatgttgccttgcacataccaacaagatcaataaccaagttgactgctggcttcggcttaaacactgcct |
44694703 |
T |
|
| Q |
198 |
tccttgaagcttcattgaccttgtaagatatatccatcaaaaactactggtgatctataaactaactttaggatgtaattaatcgttactgcttagtgtt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44694702 |
tccttgaagcttcattgaccttgtaagatatatccatcaaaaactactggtgatctataaactaactttaggatgtaattaatcgttactgcttagtgtt |
44694603 |
T |
|
| Q |
298 |
ctgctactgtttctttt |
314 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44694602 |
ctgctactgtttctttt |
44694586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University