View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1274_low_62 (Length: 301)

Name: NF1274_low_62
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1274_low_62
NF1274_low_62
[»] chr1 (1 HSPs)
chr1 (105-222)||(32670615-32670732)


Alignment Details
Target: chr1 (Bit Score: 114; Significance: 8e-58; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 105 - 222
Target Start/End: Complemental strand, 32670732 - 32670615
Alignment:
105 atacgatggaccatatcaaccagtttatgttcaaaacgttagctgctttaccgtttgccgcatcgtacttgtcgtgaggtgcatagcagagcgacagaga 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
32670732 atacgatggaccatatcaaccagtttatgttcaaaacgttagctgctttaccgtttgccgcatcgtacttgccgtgaggtgcatagcagagcgacagaga 32670633  T
205 cgatactccgccctctct 222  Q
    ||||||||||||||||||    
32670632 cgatactccgccctctct 32670615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University