View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1274_low_62 (Length: 301)
Name: NF1274_low_62
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1274_low_62 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 8e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 105 - 222
Target Start/End: Complemental strand, 32670732 - 32670615
Alignment:
| Q |
105 |
atacgatggaccatatcaaccagtttatgttcaaaacgttagctgctttaccgtttgccgcatcgtacttgtcgtgaggtgcatagcagagcgacagaga |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32670732 |
atacgatggaccatatcaaccagtttatgttcaaaacgttagctgctttaccgtttgccgcatcgtacttgccgtgaggtgcatagcagagcgacagaga |
32670633 |
T |
 |
| Q |
205 |
cgatactccgccctctct |
222 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
32670632 |
cgatactccgccctctct |
32670615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University