View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1274_low_66 (Length: 295)
Name: NF1274_low_66
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1274_low_66 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 29 - 228
Target Start/End: Complemental strand, 27171583 - 27171383
Alignment:
| Q |
29 |
tcgaataatataacaaacaaaactctagagtaatttgcaacttaaaataaaagtaaacaagttgttaaaaaccataactaactatctaaggtt-gtatat |
127 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27171583 |
tcgaacaacataacaaacaaaactctagagtaatttgcgacttaaaataaaagtaaacaagttcttaaaaaccataactaactatctaaggtttgtatat |
27171484 |
T |
 |
| Q |
128 |
tacaaaccagtaactataaccctagaactctccaccgccacaacctccaccatgatgacttccatcatctccagatttaaagacttgcgcatcatcattc |
227 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||||||||| |||||| || ||||||||||||||||||||||||| |
|
|
| T |
27171483 |
tacaaaccagtaactataatcctaagactctccacttccacaacctccaccatgatgacttccaccatctctagctttaaagacttgcgcatcatcattc |
27171384 |
T |
 |
| Q |
228 |
t |
228 |
Q |
| |
|
| |
|
|
| T |
27171383 |
t |
27171383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University