View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1274_low_74 (Length: 280)

Name: NF1274_low_74
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1274_low_74
NF1274_low_74
[»] chr3 (1 HSPs)
chr3 (91-280)||(50473452-50473642)


Alignment Details
Target: chr3 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 91 - 280
Target Start/End: Complemental strand, 50473642 - 50473452
Alignment:
91 tatagaagtctccgatagactaaaa-ctaacacaacnnnnnnngttgaatatacttagtcttaacttttgttgactcataaactgcaattactcagatat 189  Q
    ||||||||||||||||||||||||| ||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50473642 tatagaagtctccgatagactaaaaactaacacaacaaaaaaagttgaatatacttagtcttaacttttgttgactcataaactgcaattactcagatat 50473543  T
190 attataatgatgatgactattttaatatggagagggaacatgtgatattcttagtaatctgactactgtaatgtaactcccaagtagaaat 280  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50473542 attataatgatgatgactattttaatatggagagggaacatgtgatattcttagtaatctgactactgtaatgtaactcccaagtagaaat 50473452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University