View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1274_low_90 (Length: 251)
Name: NF1274_low_90
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1274_low_90 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 20 - 156
Target Start/End: Complemental strand, 21547245 - 21547109
Alignment:
| Q |
20 |
cttttcataaaggcaaacaaggatgatgaatatcccgccgattttaaggtctgttacacaaccttcaaagatggtgcacgtcaaaattgaacctaaggaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21547245 |
cttttcataaaggcaaacaaggatgatgaatatcctgccgattttaaggtctgttacacaaccttcaaagatggtgcacgtcaaaattgaacctaaggat |
21547146 |
T |
|
| Q |
120 |
tagagttgcatgtgctgttgttgacaaggagcatcta |
156 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21547145 |
tagagttgcatgtgctgttgttgacgaggagcatcta |
21547109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 206 - 243
Target Start/End: Complemental strand, 21547059 - 21547022
Alignment:
| Q |
206 |
acaacaattaccatggttgtttctgttctgttcatctc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21547059 |
acaacaattaccatggttgtttctgttctgttcatctc |
21547022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 21 - 156
Target Start/End: Original strand, 9452233 - 9452368
Alignment:
| Q |
21 |
ttttcataaaggcaaacaaggatgatgaatatcccgccgattttaaggtctgttacacaaccttcaaagatggtgcacgtcaaaattgaacctaaggaat |
120 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||||||||||||| |||| | || | ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9452233 |
ttttcataaatgcagacaaggatgatgaatatcccgccgattttaaggtttgttgcgcatcattcaaagatggtgaacgtcaaaattgaacctaaggaat |
9452332 |
T |
|
| Q |
121 |
agagttgcatgtgctgttgttgacaaggagcatcta |
156 |
Q |
| |
|
||||||| | || |||||||||| | ||||||||| |
|
|
| T |
9452333 |
agagttgaacatgttgttgttgacgaagagcatcta |
9452368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University