View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1274_low_94 (Length: 251)

Name: NF1274_low_94
Description: NF1274
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1274_low_94
NF1274_low_94
[»] chr1 (1 HSPs)
chr1 (30-157)||(30367004-30367131)
[»] chr6 (2 HSPs)
chr6 (30-153)||(31376664-31376787)
chr6 (163-209)||(31397810-31397856)


Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 30 - 157
Target Start/End: Complemental strand, 30367131 - 30367004
Alignment:
30 aaaactaaggtgaaatggtcattgaaatttgacagatgacgcaacaccgacagtagcataccaactattggccatttcggcataatttcaccgccattgt 129  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |||||||||||||    
30367131 aaaactaaggtgaaatggtcattgaaatttgacagatgacgcaacaccgacaatagcataccaactattggccaattcggcataatctcaccgccattgt 30367032  T
130 gtcgccaatagtagaagtaaatgaagaa 157  Q
    |||||| |||||||| ||||||||||||    
30367031 gtcgcctatagtagatgtaaatgaagaa 30367004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 30 - 153
Target Start/End: Original strand, 31376664 - 31376787
Alignment:
30 aaaactaaggtgaaatggtcattgaaatttgacagatgacgcaacaccgacagtagcataccaactattggccatttcggcataatttcaccgccattgt 129  Q
    ||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||  |||||| |||||||||||||    
31376664 aaaactaaggtgacatggttattgaaatttgacagatgacgcaacaccgacagtagcataccaactattggccaattcatcataatctcaccgccattgt 31376763  T
130 gtcgccaatagtagaagtaaatga 153  Q
    ||||||||||||||| ||||||||    
31376764 gtcgccaatagtagatgtaaatga 31376787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 163 - 209
Target Start/End: Complemental strand, 31397856 - 31397810
Alignment:
163 tggcaggtagagcagtctaatttttctaacgaaccttactgatgtag 209  Q
    |||||||||||||||||||||||||  ||| ||||| ||||||||||    
31397856 tggcaggtagagcagtctaatttttggaaccaacctgactgatgtag 31397810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University