View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1275-Insertion-14 (Length: 178)
Name: NF1275-Insertion-14
Description: NF1275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1275-Insertion-14 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 8 - 178
Target Start/End: Complemental strand, 117641 - 117466
Alignment:
| Q |
8 |
tataagactcctgactattctacctttacccaggaagatggaaaatcaaccatggagctcattggaaaatgtacaacgtaatgtagcaagggaaa----c |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | | | | | | |
|
|
| T |
117641 |
tataagactcctgactattctacctttacccgggaagatggaaaatcaaccatggagctcattggaaaatgtacaacgtaatattacgttgtacattttc |
117542 |
T |
|
| Q |
104 |
ca-aaacgaattccacaaacttcacttgttccctttatcgttgacatgaacatcatttacgtgatattcctgtata |
178 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
117541 |
cacaaacgaattccacaaacttcacttgttccctttatcgttgacatgaacatcatttacgtgatattcctgtata |
117466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University