View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1275-Insertion-6 (Length: 319)
Name: NF1275-Insertion-6
Description: NF1275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1275-Insertion-6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 286; Significance: 1e-160; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 8 - 309
Target Start/End: Original strand, 2669815 - 2670116
Alignment:
| Q |
8 |
atatggtcatcaaatcaaactatttcctctgttacaaaccctgttcttcatcttttggatgatggaaatttggttctcaaagaagcacaagagaaaaaca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2669815 |
atatggtcatcaaatcaaactatttcctctgttacagaccctgttcttcatcttttggatgatggaaatttggttctcaaagaagcacaagagaaaaaca |
2669914 |
T |
|
| Q |
108 |
acagtaactatatatggcagagttttgatcatccaacagatactttgttaccaggtatgaaacttggttggaaccttgacactggtatcgagattcgaat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2669915 |
acagtaactatatatggcagagttttgatcatccaacagatactttgttaccagggatgaaacttggttggaaccttgacactggtgtcgagattcgaat |
2670014 |
T |
|
| Q |
208 |
aacttcgtggaaaagtcaagatgatccatcaactggagatagtcatttcagtcttgattatcatggtgttccagatatttacttgtggaacaagcaacaa |
307 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2670015 |
aacttcatggaaaagtcaagatgatccatcaactggagatagtcatttcagtcttgattatcatggtgttccagatatttacttgtggaacaagcaacaa |
2670114 |
T |
|
| Q |
308 |
ag |
309 |
Q |
| |
|
|| |
|
|
| T |
2670115 |
ag |
2670116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 120 - 160
Target Start/End: Complemental strand, 2686112 - 2686072
Alignment:
| Q |
120 |
tatggcagagttttgatcatccaacagatactttgttacca |
160 |
Q |
| |
|
||||||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
2686112 |
tatggcaaagctttgattatccaacagatactttgttacca |
2686072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 120 - 181
Target Start/End: Original strand, 36360961 - 36361022
Alignment:
| Q |
120 |
tatggcagagttttgatcatccaacagatactttgttaccaggtatgaaacttggttggaac |
181 |
Q |
| |
|
||||||| ||||||||| | || ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36360961 |
tatggcaaagttttgattaccctacagatactttgttacctggtatgaaacttggttggaac |
36361022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University