View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12750_high_15 (Length: 296)
Name: NF12750_high_15
Description: NF12750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12750_high_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 12 - 279
Target Start/End: Complemental strand, 6722956 - 6722697
Alignment:
| Q |
12 |
atgaaaaatagcatcatctgagagaaactaagatatgatcactaaattaacaaaaacaaatatgtatgtttcaaaatcatgttgtccagtctctttcaag |
111 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
6722956 |
atgaaaaatagcatcatcagagagaaaccaagatatgatcactaaattaacaaaaacaaatatgtatgtttcaaaatcatgtttttcagtctctttcaag |
6722857 |
T |
|
| Q |
112 |
attttgaaatcaaaagtaccaatttttcagagagaaaccaagagtacgaagagtgaattagatgattagatgattacgaagagtgagaacagtgaatgaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||| |||||||||| |
|
|
| T |
6722856 |
attttgaaatcaaaagtaccaatttttcagagagaaaccaagagtacgaagagtga--------atgagatgattacgaagagtgggaatagtgaatgaa |
6722765 |
T |
|
| Q |
212 |
atcaaaaataacaattttatacaggcaaagaaacatgcattgtttcaatgtttccacatgcatgaatt |
279 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6722764 |
atcaaaaataacaattttatataggcaaagaaacatgcattgtttcaatgtttccacatgcatgaatt |
6722697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University