View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12751_high_16 (Length: 219)
Name: NF12751_high_16
Description: NF12751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12751_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 15 - 201
Target Start/End: Complemental strand, 40311662 - 40311475
Alignment:
| Q |
15 |
atgaactttgaggcaattgaggaattccctttcagttgtaaattgtaataacctaagtagctccgacacttttgtccggctacacattaaca-catgtta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
40311662 |
atgaactttgaggcaattgaggaattccctttcagttgtaaattgtaataacctaagtagctccgacacttttgtccggctacacactaacggcatgtta |
40311563 |
T |
 |
| Q |
114 |
ttacattcggcgtttgtgtccctgttagggcttcataggtaaaaactgtattgcataccctttcagcaaggctgtggctatctgttgc |
201 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40311562 |
ttacattcggcgtttgtgtccgtgttagggcttcataggtaaaaactgtattgcataccctttcagcaaggctgtggctatctgttgc |
40311475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University