View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12751_low_20 (Length: 219)

Name: NF12751_low_20
Description: NF12751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12751_low_20
NF12751_low_20
[»] chr8 (1 HSPs)
chr8 (15-201)||(40311475-40311662)


Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 15 - 201
Target Start/End: Complemental strand, 40311662 - 40311475
Alignment:
15 atgaactttgaggcaattgaggaattccctttcagttgtaaattgtaataacctaagtagctccgacacttttgtccggctacacattaaca-catgtta 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||  |||||||    
40311662 atgaactttgaggcaattgaggaattccctttcagttgtaaattgtaataacctaagtagctccgacacttttgtccggctacacactaacggcatgtta 40311563  T
114 ttacattcggcgtttgtgtccctgttagggcttcataggtaaaaactgtattgcataccctttcagcaaggctgtggctatctgttgc 201  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40311562 ttacattcggcgtttgtgtccgtgttagggcttcataggtaaaaactgtattgcataccctttcagcaaggctgtggctatctgttgc 40311475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University