View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12753_high_8 (Length: 238)
Name: NF12753_high_8
Description: NF12753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12753_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 26879980 - 26879757
Alignment:
| Q |
1 |
tacttactagatctttgcgttttttctgcttttgctacatgtcatatttgttttgatctttattgccacaaaatttgcttgttgatgaattaaagctagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26879980 |
tacttactagatctttgcgttttttctgcttttgctacatgtcatatttgttttgatctttattgccacagaatttgcttgttgatgaattaaagctagc |
26879881 |
T |
 |
| Q |
101 |
agaaattggcccaaaatttgaacatcatgagatgttcccagcacggactaacagtcagattagtcaattttttatgatcgcaatatggctatcaacttta |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26879880 |
agaaattggcccaaaatttgaacattatgagatgttcccagcacggactaacagtcagattagtcaattttttatgatcgcaatatggctatcaacttta |
26879781 |
T |
 |
| Q |
201 |
ttatgatatttatcccatatacct |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
26879780 |
ttatgatatttatcccatatacct |
26879757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 21 - 153
Target Start/End: Complemental strand, 40249495 - 40249366
Alignment:
| Q |
21 |
tttttctgcttttgctacatgtcatatttgttttgatctttattgccacaaaatttgcttgttgatgaattaaagctagcagaaattggcccaaaatttg |
120 |
Q |
| |
|
|||||||| |||| ||| ||||||||||||||||||||| | ||| ||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40249495 |
tttttctgattttccta-atgtcatatttgttttgatct--actgcaacagaatttgcttgttgatgaattgaagctagcagaaattggcccaaaatttg |
40249399 |
T |
 |
| Q |
121 |
aacatcatgagatgttcccagcacggactaaca |
153 |
Q |
| |
|
||||||| ||| ||||||| ||||| ||||||| |
|
|
| T |
40249398 |
aacatcacgaggtgttccctgcacgaactaaca |
40249366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University