View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12753_low_9 (Length: 240)
Name: NF12753_low_9
Description: NF12753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12753_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 143 - 228
Target Start/End: Complemental strand, 53721530 - 53721445
Alignment:
| Q |
143 |
gcaggaatcaggatcctcatagaatttccttgctaaaaagatggatggtgaaatcagatnnnnnnngtcgctttctgcctatgctt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
53721530 |
gcaggaatcaggatcctcatagaatttccttgctaaaaagatggatggtgaaatcagataaaaaaagtcgctttctgcctctgctt |
53721445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 23 - 73
Target Start/End: Complemental strand, 53721651 - 53721601
Alignment:
| Q |
23 |
agctgccatgccaaactcctgtggattactgagagacacgggtatgcatac |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53721651 |
agctgccatgccaaactcctgtggattactgagagacacgggtatgcatac |
53721601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University