View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12755_low_13 (Length: 202)
Name: NF12755_low_13
Description: NF12755
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12755_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 8 - 189
Target Start/End: Original strand, 3717484 - 3717665
Alignment:
| Q |
8 |
ggagaagcagagaggtgagtgtggtgttctcatttttcactatgagtttgtaccatatgcttctttcgtgggataccagggcattcacagagattttgtg |
107 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3717484 |
ggagaaacaaagaggtgagtgtggtgttctcatttttcactatgagttggtactctatgcttctttcgtgggataccagggcattcactgagattttgtg |
3717583 |
T |
 |
| Q |
108 |
agaatttattccccatggatttcactgatggagtttgtggatagaggacaagaactttgagcaaagtttcatcatatgatgt |
189 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3717584 |
agaatttattccccatggatttcgatgatggagtttgtggatagaggacaagaactttgagcaaagtttcatcatatgatgt |
3717665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University