View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12756_high_10 (Length: 241)
Name: NF12756_high_10
Description: NF12756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12756_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 36 - 240
Target Start/End: Complemental strand, 46587198 - 46586993
Alignment:
| Q |
36 |
agggatcaaacaatttttatccaaatttattagactaggannnnnnnn-aataacacaccggttaatgttggaattattagataataagattgaagttat |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46587198 |
agggatcaaacaatttttatccaaatttattagactaggatttttttttaataacacaccggttaatgttggaattattagataataagattgaagttat |
46587099 |
T |
 |
| Q |
135 |
gttatgagtcctttaagttttaagttagtagagcccattctcttgtaacattttgacacatcataccatttgatattattggaaccctaaccatgcatct |
234 |
Q |
| |
|
|| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46587098 |
gtcatgagtcctttaaattttaagttagtagagcccattctcttgtaacattttgacacatcataccatttgatattattggaaccctaaccatgcatct |
46586999 |
T |
 |
| Q |
235 |
cctttg |
240 |
Q |
| |
|
|||||| |
|
|
| T |
46586998 |
cctttg |
46586993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University