View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12756_low_12 (Length: 241)
Name: NF12756_low_12
Description: NF12756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12756_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 100 - 203
Target Start/End: Original strand, 46950095 - 46950199
Alignment:
| Q |
100 |
aaataaaattatacaatacttcggattaaggatatgctaaatcattaagagatatagcaaaagg-tttaagatatctgactctctaaaagtccaacttat |
198 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |||||||||| |
|
|
| T |
46950095 |
aaataaaattatataatacttcagattaaggatatgctaaatcattaagagatatagcaaaaggttttaagatatctgactctctaagactccaacttat |
46950194 |
T |
|
| Q |
199 |
ctgaa |
203 |
Q |
| |
|
||||| |
|
|
| T |
46950195 |
ctgaa |
46950199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 38 - 99
Target Start/End: Original strand, 46950059 - 46950120
Alignment:
| Q |
38 |
ataaaatgaaaccttaaaccaaccgcaccagatgagaaataaaattatataatacttcagat |
99 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46950059 |
ataaaatgaaacattaaaccaaccgcaccagatgagaaataaaattatataatacttcagat |
46950120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University