View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12757_high_23 (Length: 228)
Name: NF12757_high_23
Description: NF12757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12757_high_23 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 2448986 - 2449213
Alignment:
| Q |
1 |
cacttgatttaagaaaatgataattaaagaatgaaggttaaatacataccactttgtattatagagtcatgaatattaactcgaattgagtttgagatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2448986 |
cacttgatttaagaaaatgataattaaagaatgaaggttaaatacataccactttgtattatagagtcatgaatattaactcgaattgagtttgagatat |
2449085 |
T |
 |
| Q |
101 |
caattccatcggtgttgtaactatcttttggcgaacttatgttaatatgcgagattgttacatcttgactatggactacatagacatgcattgctggtcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2449086 |
caattccatcggtgttgtaactatcttttgacgaacttatgttaatatgcgagattgttacatcttgactatggactacatagacatgcattgctggccc |
2449185 |
T |
 |
| Q |
201 |
atttatatgagtcagtccacttaattga |
228 |
Q |
| |
|
|||||||||||| ||||||||||||||| |
|
|
| T |
2449186 |
atttatatgagttagtccacttaattga |
2449213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University