View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12757_low_20 (Length: 245)
Name: NF12757_low_20
Description: NF12757
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12757_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 12 - 223
Target Start/End: Original strand, 52688197 - 52688408
Alignment:
| Q |
12 |
aagcaaaggttatcgaatttaaaacttaagtcattttaaatgtgtgtaattatttggttatgatgatgccacttagtggttgccattatggatgaataac |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52688197 |
aagcaaaggttagcgaatttaaaacttaagtcattttaaatgtgtgtaattatttggttatgatgatgccacttagtggttgccattatggatgaataac |
52688296 |
T |
 |
| Q |
112 |
tgccattttatatggcactagaggaatattgagactcccattggggatatcacacgtcagtattcatctttgaatgatattttgatcgtattgggacgtt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52688297 |
tgccattttatatggcactagaggaatattgagactcccattggggatatcacacgtcaatattcacctttgaatgatattttgatcgtattgggacgtt |
52688396 |
T |
 |
| Q |
212 |
acccgcaacaca |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
52688397 |
acccgcaacaca |
52688408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University