View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12759_high_6 (Length: 261)

Name: NF12759_high_6
Description: NF12759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12759_high_6
NF12759_high_6
[»] chr4 (3 HSPs)
chr4 (111-239)||(29631638-29631766)
chr4 (12-76)||(29631539-29631603)
chr4 (174-207)||(28390248-28390281)


Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 111 - 239
Target Start/End: Original strand, 29631638 - 29631766
Alignment:
111 ctcagcagctagctattgcaatacaacggactgtgataacgctggaaacgacaaacacacgtcgttttcagatctcggactctcggaatggatggtgcgg 210  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||    
29631638 ctcagcagctagctattgtaatacaacggactgtgataacgctggaaacgacaaacacatgtcgttttcagatctaggactctcggaatggatggtgcgg 29631737  T
211 ggttgcgataaactcgggatgcaatctcc 239  Q
    |||||||||||||||||||||||||||||    
29631738 ggttgcgataaactcgggatgcaatctcc 29631766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 12 - 76
Target Start/End: Original strand, 29631539 - 29631603
Alignment:
12 aacctgtgagtcgcactctctcctttccctttcttccttcctggtcaaccgtaacagcttacttc 76  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29631539 aaccagtgagtcgcactctctcctttccctttcttccttcctggtcaaccgtaacagcttacttc 29631603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 174 - 207
Target Start/End: Complemental strand, 28390281 - 28390248
Alignment:
174 gttttcagatctcggactctcggaatggatggtg 207  Q
    ||||||||||||||||||||| ||||||||||||    
28390281 gttttcagatctcggactctcagaatggatggtg 28390248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University