View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12759_low_4 (Length: 357)
Name: NF12759_low_4
Description: NF12759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12759_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 6e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 6e-99
Query Start/End: Original strand, 115 - 337
Target Start/End: Original strand, 15592059 - 15592281
Alignment:
| Q |
115 |
tcaatctaactaatgctaattcaatgatatctattaaaataaaattctaatcaatggtgtaacttgtatcgtaagtaatccagatgcattgagtagtatc |
214 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15592059 |
tcaatctaactaatgcgaattcaatgatatctattaaaataaaattctaatcaatggattaacttgtatcgtaagtaatccagatgcattgagtagtatc |
15592158 |
T |
 |
| Q |
215 |
tttggtcacaatggctgcaacgatctctcttctttgaatgccttagttccatcattaggcaaacttgtatcaatgttatgatcttcatttatttcaacat |
314 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||| |||| ||||||| |||||||| ||||| |
|
|
| T |
15592159 |
tttggtcaaaatggctgcaacgatctctcttctttgaatgtcttagttccatcactaggcaaacttgtatcattgttctgatctttatttatttgaacat |
15592258 |
T |
 |
| Q |
315 |
ttgattttgtgtttccttcacct |
337 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
15592259 |
ttgattttgtgtttccttcacct |
15592281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University