View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12759_low_9 (Length: 268)
Name: NF12759_low_9
Description: NF12759
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12759_low_9 |
 | |
|
| [»] scaffold0489 (1 HSPs) |
| | |
|
| [»] scaffold0140 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0489 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: scaffold0489
Description:
Target: scaffold0489; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 20 - 262
Target Start/End: Complemental strand, 10118 - 9876
Alignment:
| Q |
20 |
ttgtcccttcaacataaccctacaacccttggtactttgcctgatcagatgaaaccctcatcaagtttttctcattctcatgaacatccaccaaacctga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10118 |
ttgtcccttcaacataaccctacaacccttggtactttgcctgatcagatgaaaccctcatcaagtttttctcattctcatgaacatccaccaaacctga |
10019 |
T |
|
| Q |
120 |
atattccatctccatatgcatcaagctatgaaaacatttctagattgatggaaacttggatgaaatcacctaactcatcagctgaaacgaattcctcatc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10018 |
atattccatctccatatgcatcaagctatgaaaacatttctagattgatggaaacttggatgaaatcacctaactcatcagctgaaacgaattcctcatc |
9919 |
T |
|
| Q |
220 |
aatattcagcaacatgcagggatcaagttgcagtgaacgagca |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
9918 |
aatattcagcaacatgcagggatcaagttgtagtgaaggagca |
9876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 20 - 262
Target Start/End: Original strand, 10910 - 11152
Alignment:
| Q |
20 |
ttgtcccttcaacataaccctacaacccttggtactttgcctgatcagatgaaaccctcatcaagtttttctcattctcatgaacatccaccaaacctga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10910 |
ttgtcccttcaacataaccctacaacccttggtactttgcctgatcagatgaaaccctcatcaagtttttctcattctcatgaacatccaccaaacctga |
11009 |
T |
|
| Q |
120 |
atattccatctccatatgcatcaagctatgaaaacatttctagattgatggaaacttggatgaaatcacctaactcatcagctgaaacgaattcctcatc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11010 |
atattccatctccatatgcatcaagctatgaaaacatttctagattgatggaaacttggatgaaatcacctaactcatcagctgaaacgaattcctcatc |
11109 |
T |
|
| Q |
220 |
aatattcagcaacatgcagggatcaagttgcagtgaacgagca |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
11110 |
aatattcagcaacatgcagggatcaagttgtagtgaaggagca |
11152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University