View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1275R-Insertion-1 (Length: 111)
Name: NF1275R-Insertion-1
Description: NF1275R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1275R-Insertion-1 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 2e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 2e-52
Query Start/End: Original strand, 8 - 111
Target Start/End: Original strand, 2252388 - 2252491
Alignment:
| Q |
8 |
attgtggccatttatgaaacttcacgtctctccatatggcgatgctaattaactttcgcttgaagacattgttagttagcattatatatgttgcttataa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2252388 |
attgtggccatttatgaaacttcacgtctctccatatggcgatgctaattaactttcgcttgaagacattgttagttagcattatatatgttgcttataa |
2252487 |
T |
 |
| Q |
108 |
ttag |
111 |
Q |
| |
|
|||| |
|
|
| T |
2252488 |
ttag |
2252491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University