View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1275R-Insertion-2 (Length: 196)
Name: NF1275R-Insertion-2
Description: NF1275R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1275R-Insertion-2 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 9 - 196
Target Start/End: Complemental strand, 45264754 - 45264567
Alignment:
| Q |
9 |
atatatcattttgtgacaccattgtattgtatcttactgagcgaacgatagttaactaccgttgaagataaaatgatcaatttcggatgtctgaaagcta |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
45264754 |
atatatcattttgtgacaccattgtattgtatcttactaagcgaacgatagttaactaccgttgaagataaaatgatcaatttcgggtgtctgaaagcta |
45264655 |
T |
|
| Q |
109 |
ttttggaagtttaaagaacaatatactttccacaaatgtagctgacatattcctacaactacgtaggaatatgacacattcatctcca |
196 |
Q |
| |
|
||||| ||| |||||||||||||| |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45264654 |
ttttgaaagcttaaagaacaatatgctttgcacaaatgcagctgacatattcctacaactacgtaggaatatgacacattcatctcca |
45264567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 50 - 91
Target Start/End: Complemental strand, 46896252 - 46896211
Alignment:
| Q |
50 |
cgaacgatagttaactaccgttgaagataaaatgatcaattt |
91 |
Q |
| |
|
||||||||||||||||| ||||| ||||| |||||||||||| |
|
|
| T |
46896252 |
cgaacgatagttaactatcgttggagatagaatgatcaattt |
46896211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University