View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1275R-Insertion-4 (Length: 224)
Name: NF1275R-Insertion-4
Description: NF1275R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1275R-Insertion-4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 9 - 124
Target Start/End: Original strand, 39322331 - 39322446
Alignment:
| Q |
9 |
aataatagttgataaacaatttccccttcaagaatttcaaagtagcgtattatattaatatgcaaattcctgttcgaaaaaataaaatcagtcacatatt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39322331 |
aataatagttgataaacaatttccccttcaagaatttcaaagtagcgtattatattaatatgcaaattcctgttcgaaaaaataaaatcattcacatatt |
39322430 |
T |
 |
| Q |
109 |
atggtcagtgtacaaa |
124 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
39322431 |
atggtcagtgtacaaa |
39322446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 147 - 195
Target Start/End: Original strand, 39322444 - 39322492
Alignment:
| Q |
147 |
aaataatttacaaatatgcaaaagtaaagttccaggatggcacacaggt |
195 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39322444 |
aaataatttacaaataagcaaaagtaaagttccaggatggcacacaggt |
39322492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University