View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1275_high_2 (Length: 401)
Name: NF1275_high_2
Description: NF1275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1275_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 347; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 13 - 371
Target Start/End: Complemental strand, 51578872 - 51578514
Alignment:
| Q |
13 |
acagacaaaattggtatttaatatttacacaataaattaagggcaaccgattgtggtatgtcatttgtataagtccaccggtggacccttgttttagggg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51578872 |
acagacaaaattggtatttaatatttacacaataaattaagggcaaccgattgtggtatgtcatttgtataagtccaccggtggacccttgttttagggg |
51578773 |
T |
 |
| Q |
113 |
tgcatattagggatccccgtgaactactagtaaaaagaagtttttcgaaaatctcattttaatcattttacttatgattattttcatttgttatgtttgt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51578772 |
tgcatattagggatccccgtgaactactagtaaaaagaagtttttggaaaatctcattttaatcattttacttatgattattttcatttgttatgtttgt |
51578673 |
T |
 |
| Q |
213 |
cgaacattttttctcttctagtttttaaaaatacacatgctttgtacccagttctaatttcggatctaggaacacccattaattgacctattgcttttaa |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51578672 |
cgaacattttttctcttctagtttttaaaaatacacatgctttgtacccggttctaatttcagatctaggaacacccattaattgacctattgcttttaa |
51578573 |
T |
 |
| Q |
313 |
gttcgatttcttgctttgcttatatatggttcggagattgcttaatgagcggtacgatg |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51578572 |
gttcgatttcttgctttgcttatatatggttcggagattgcttaatgagcggtacgatg |
51578514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 88 - 124
Target Start/End: Complemental strand, 49356615 - 49356579
Alignment:
| Q |
88 |
caccggtggacccttgttttaggggtgcatattaggg |
124 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |
|
|
| T |
49356615 |
caccggtggacccttgttttaggggtccatattaggg |
49356579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 88 - 124
Target Start/End: Original strand, 14350161 - 14350197
Alignment:
| Q |
88 |
caccggtggacccttgttttaggggtgcatattaggg |
124 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
14350161 |
caccggtggacccttgttttaagggtccatattaggg |
14350197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University